Skip to content

odsysanie tłuszczu trójmiasto

2 miesiące ago

441 words

Ten produkt PCR został sklonowany w retrowirusowym wektorze MSCV-EGFP (uprzejmie dostarczonym przez W. Peara, University of Pennsylvania). Konstrukty z mutacjami punktowymi, konstruktami z mutacjami delecyjnymi i konstruktami znakowanymi epitopem uzyskano za pomocą PCR z klonu FIP1L1-PDGFRA i sklonowano do MSCV-EGFP. Wyszukiwanie podobieństw przeprowadzono przy użyciu programu BLAST (http://www.ncbi.nlm.nih.gov/BLAST). Hodowlę komórkową
Komórki 293T hodowano w zmodyfikowanej pożywce Eagle a Dulbecco z 10% płodową surowicą cielęcą, a komórki Ba / F3 hodowano w pożywce RPMI z 10% płodową surowicą cielęcą i ng mysiej interleukiny-3 na mililitr. Wytwarzanie retrowirusowego supernatantu i transdukcję opisano uprzednio.17 Wzrost niezależny od interleukiny-3 oceniano przez wysiewanie transdukowanych komórek Ba / F3 w pożywce wolnej od interleukiny-3, po tym, jak komórki przemywano trzy razy w soli fizjologicznej buforowanej fosforanem. Imatynib przechowywano jako 10 mM roztwór podstawowy w wodzie i rozcieńczano w pożywce RPMI do użycia. W przypadku Western blotting komórki Ba / F3 inkubowano w obecności imatynibu przez 90 minut przed lizą. Dla krzywych dawka-odpowiedź, komórki Ba / F3 inkubowano przez 24 godziny w obecności imatynibu, a liczbę żywych komórek na początku i na końcu określono za pomocą testu proliferacji w roztworze Celltiter96AQueousOne (Promega). Krzywe odpowiedzi na dawkę dopasowano za pomocą oprogramowania OriginPro 6.1 (OriginLab).
Western Blotting
Immunoprecypitację przeprowadzono stosując przeciwciało anty-MYC (Cell Signaling) i agarozę białka G (Roche). Każda procedura obejmowała 6 milionów komórek Ba / F3 ze stabilną ekspresją znakowanego MYC białka fuzyjnego FIP1L1-PDGFR. znakowanego MYC lub mutanta T674I. Komórki poddawano lizie w buforze do lizy (Cell Signaling) zawierającym mM ortowanadanu sodu, 20 uM tlenku fenyloaryny (Calbiochem) i inhibitorach proteazy (kompletne tabletki, Roche). W celu przeprowadzenia blottingu Western, zebrano komórki Ba / F3, poddano lizie w buforze do ładowania (Cell Signaling), rozdzielono przez elektroforezę w żelu poliakryloamidowym z dodecylosiarczanem sodu i przeniesiono na membrany. Zastosowano następujące przeciwciała: anty-fosfo-ERK1 / 2, anty-fosfo-STAT5 i antyfosfotyrozynę (P-Tyr-100/102, sygnalizacja komórkowa), anty-PDGFR. (Upstate), anty-STAT5b (Santa-Cruz), peroksydazy antymodalnej i peroksydazy przeciwprzyczepnej (Amersham Pharmacia Biotech). Detekcję przeprowadzono przy użyciu systemu Western Lightning (Perkin Elmer).
Primers
Zastosowano następujące startery: PDGFRA-F3, 5 gagcgagaaccgagagctc; PDGFRA-F5, 5 caaagtggaggagaccatcg; PDGFRA-F14, 5 gaacattgtaaacttgctggg; PDGFRA-R1, 5 tgagagcttgtttttcactgga; PDGFRA-R2, 5 gggaccggcttaatccatag; PDGFRA-R3, 5 ggctgctcaccacacaccac; PDGFRA-R12, 5 catagctccgtgctttca; PDGFRA-R15, 5 catagctccgtgtgctttca; PDGFRA-Rc, 5 cgaattcccagttacaggaagctgtct; FIP1L1-Fc, 5 tggatcccggccatgtcggccggcgag; FIP1L1-F4, 5 acctggtgctgatctttctgat; FIP1L1-F5, 5 aaagaggatacgaatgggacttg; FIP1L1-R1, 5 agtgctgacagtcggaggag; FIP1L1-R2, 5 gagctcctggagggaaaaac; LDI1, 5 gaacgtacgatgtttggtttcca; LDI2, 5 gtctctaatcccatccaggttgc; GAPDH-F, 5 tggaaatcccacccatcatct; i GAPDH-R, 5 gtcttctgggtggcagtgat.
Wyniki
Reakcja na Imatinib u pacjentów z zespołem hipereozynofilowym
Średni wiek 11 pacjentów (9 mężczyzn i 2 kobiet), którzy otrzymywali imatynib, wynosił 46 lat (zakres od 28 do 61) (Tabela 1)
[hasła pokrewne: asymetria ułożeniowa, klinika stomatologiczna częstochowa, artroskopia biodra nfz ]
[więcej w: asymetria ułożeniowa, ziarniak naczyniowy, pasaż ursynowski 1 ]

0 thoughts on “odsysanie tłuszczu trójmiasto”